VNUHCM Journal of

Engineering and Technology

An official journal of Viet Nam National University Ho Chi Minh City, Viet Nam since 2018

ISSN 2615-9872

Skip to main content Skip to main navigation menu Skip to site footer

 Research article

HTML

1494

Total

429

Share

Screening for in vitro inhibiting Nrf2 of some Vietnamese medicinal plants






 Open Access

Downloads

Download data is not yet available.

Abstract

Nuclear factor erythroid 2–related factor 2 (Nrf2) is vital in regulating cellular defenses against oxidative or environmental aggressors. Some studies reveal that increasing Nrf2 activity affects chemotherapy drug resistance in cancer; thus, Nrf2 has become an attractive target in cancer therapeutics research. Our study screened the effects of 52 methanol extracts from different parts of 24 medicinal plants used in traditional and folk medicine to evaluate the ability to inhibit Nrf2 and the cell viability by an in vitro model of Huh7 liver cancer cells at the crude extract concentration of 100 µg/mL. The study has successfully suggested a screening model for Nrf2 expression based on luciferase fluorescence assay of Huh7 cells transfected with the Nrf2 gene. The results of our study show that the Piper sarmentosum roots can inhibit nearly 90% of Nrf2 activity in cancer cells. We also found that the extracts of Vernonia amygdalina leaves, Phyllanthus amarus leaves, Zingiber zerumbet leaves, Hyptis suaveolens leaves and roots, Curcuma zedoaria leaves and roots, Luvunga scandens leaves, Helicteres hirsuta leaves, Oroxylum indicum stem and leaves, Lasia spinosa fruits and Crotalaria pallida leaves inhibited more than 60% of Nrf2 expression levels. Furthermore, the extracts from the leaves of Luvunga scandens and Curcuma zedoaria can cause toxicity on cancer cell of more than 70% at 100 µg/mL. From the study, we have the basis for further studies on natural active substances that have the effect of drug resistance by inhibiting the expression of Nrf2 on cancer cells.

Mở đầu

Ung thư được định nghĩa là hiện tượng tăng sinh bất thường của tế bào với khả năng xâm lấn hoặc lây lan sang các cơ quan khác của cơ thể 1 . Ước tính đến năm 2040, số ca mắc ung thư mới có thể lên đến 28,4 triệu, trong đó khu vực Châu Á thuộc top đầu khu vực có tỷ lệ mắc ung thư cao nhất với khoảng 5,5 triệu ca mới, và khoảng 4,02 triệu ca tử vong do ung thư 2 . Hiện nay, nhiều phương pháp khác nhau đã được áp dụng trong điều trị ung thư, tuy nhiên sử dụng thuốc hóa trị vẫn là một trong những liệu pháp phổ biến nhất. Dự đoán đến năm 2040, nhu cầu sử dụng thuốc hóa trị lần đầu cho bệnh nhân ung thư sẽ tăng từ 9,8 lên 15,0 triệu, với tỷ lệ gia tăng là 53% 3 . Tuy nhiên, thực tế cho thấy 50% trường hợp cơ thể bệnh nhân đã có đề kháng với thuốc hóa trị trước khi được tiến hành điều trị và 50% còn lại xuất hiện trong quá trình điều trị 4 . Tình trạng kháng thuốc làm cho bệnh nhân không đạt hiệu quả điều trị mong muốn mà còn có thể bị ảnh hưởng xấu bởi tác dụng phụ của thuốc 5 , được xem là nguyên nhân của hơn 90% trường hợp tử vong ở bệnh nhân ung thư đã di căn 6 . Do đó, việc nghiên cứu mô hình đánh giá tình trạng kháng thuốc ung thư cũng như kết hợp nghiên cứu các hợp chất có tác dụng hỗ trợ ức chế và/hoặc đảo ngược kháng thuốc điều trị ung thư là nhu cầu hết sức cần thiết.

Nhiều mô hình thử nghiệm đã được đưa ra nhằm đánh giá cơ chế hình thành kháng thuốc trên tế bào ung thư, mô hình tiền lâm sàng gồm mô hình in vitro in vivo nhằm nghiên cứu khả năng ức chế khối u của các hoạt chất, nghiên cứu cơ sở hình thành kháng thuốc nội tại và kháng thuốc mắc phải trong quá trình điều trị 7 . Hầu hết các mô hình được sử dụng để nghiên cứu thường tập trung vào tín hiệu của protein ức chế hoặc hoạt hóa apoptosis như con đường PI3K/Akt 8 , con đường Raf/MEK/ERK 9 dựa trên phương pháp PCR, Western Blot và các phương pháp tương đương 10 . Nuclear factor erythroid-2 p45-related factor 2 (Nrf2) là một yếu tố phiên mã có vai trò bảo vệ tế bào, kể cả tế bào thường và cả tế bào ác tính, khỏi tác động từ các phản ứng oxi hóa, mất cân bằng nội môi và các tổn thương do DNA 11 . Đối với các tế bào ung thư, hoạt động của Nrf2 dẫn đến tình trạng kháng thuốc hóa trị và được chứng minh là thúc đẩy sự tăng sinh ở tế bào ung thư 12 , 13 . Ngoài ra, kích hoạt Nrf2 cũng có liên quan đến sự phát triển và di căn của khối u ở một số bệnh ung thư 14 , 15 . Nghiên cứu về con đường Nrf2/Keap1 hiện nay đang thu hút được sự quan tâm của nhiều nhà khoa học vì một số nghiên đã chứng minh rằng việc trực tiếp hoặc gián tiếp ức chế biểu hiện Nrf2 có thể làm các tế bào ung thư trở nên nhạy với hóa trị 16 , 17 , 18 , 19 và đảo ngược tình trạng kháng thuốc điều trị 20 . Do đó, nghiên cứu các chất ức chế Nrf2 có thể là một chiến lược điều trị đầy hứa hẹn đối với một số loại ung thư và nâng cao hiệu quả của các loại thuốc hóa trị liệu.

Nhiều nghiên cứu đã cho thấy khả năng làm giảm/ức chế/đảo ngược tình trạng kháng thuốc hóa trị, thể hiện tác động cộng gộp khi sử dụng kết hợp một số hợp chất chuyển hóa thứ cấp từ thực vật với thuốc điều trị ung thư và khả năng làm giảm độc tính của thuốc điều trị ung thư 21 , 22 . Một số flavonoid được báo cáo rộng rãi với khả năng tái nhạy cảm tế bào kháng thuốc với thuốc hóa trị và đảo ngược tình trạng kháng thuốc thông qua nhiều cơ chế khác nhau 23 , 24 , 25 . Theo nghiên cứu của Tang và cộng sự, 2011, flavone luteolin có khả năng ức chế mạnh với Nrf2 với kết quả làm giảm 34% mức Nrf2 mRNA khi điều trị cùng với actinomycin D sau 30 phút và 43% sau 1,5 giờ đối với tế bào ung thư biểu mô phổi A549 ở người 26 . Luteolin còn thể hiện khả năng ức chế hoạt động của Nrf2 ở gan chuột và trong các khối u xenograft mà không thể hiện tác dụng gây độc tế bào 27 . Ngoài ra, một số hợp chất như quercetin, curcumin cũng đang được đưa vào thử nghiệm lâm sàng để khắc phục tình trạng kháng thuốc ung thư 28 , 29 , 30 , 31 .

Việt Nam được biết đến có nguồn cây thuốc và dược liệu phong phú với hơn 4.000 loài thực vật được ghi nhận có công dụng làm thuốc 32 . Tuy nhiên, hiện nay vẫn chưa có nhiều nghiên cứu liên quan đến việc sử dụng dược liệu và cây thuốc Việt Nam trong việc điều trị hay hỗ trợ điều trị kháng thuốc ung thư. Trong nghiên cứu này, danh mục 24 loài dược liệu và cây thuốc sử dụng trong dân gian và y học cổ truyền trong việc hỗ trợ điều trị ung thư được thiết lâp. 52 bộ phận khác nhau của 24 loài dược liệu và cây thuốc này được thu thập để đánh giá khả năng sống sót của tế bào cũng như khả năng ức chế Nrf2 in vitro đối với tế bào Huh7 từ các cao methanol thu được. Từ đó đưa ra định hướng để chọn lọc và phát triển các hợp chất có khả năng ức chế biểu hiện của Nrf2 đối với tế bào ung thư.

Phương pháp nghiên cứu

Hóa chất, nguyên liệu và thiết bị

Hóa chất, nguyên liệu

Môi trường Eagle sửa đổi của Dulbecco (DMEM), Huyết thanh nhau thai bò (FBS), Streptomycin, Acid amin không thiết yếu, L-glutamin, Thuốc thử TRIzol Puromycin, Hygromycin, Tris, Sodium Chloride, EDTA, NP-40, Sodium Dodecyl Sulfate (SDS), chất ức chế protease và phosphatase, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), Alamarblue (Thermo Fisher Scientific, Mỹ); anti-NRF2 (GTX103322, GeneTex, Mỹ), anti-GAPDH (60004-1g, Proteintech, Mỹ), anti-KEAP1 (10503-2-AP, Proteintech, Mỹ), anti-lamin B1 (66095-1-Ig, Proteintech, Mỹ); KAPA SYBR FAST qPCR Master Mix (2X) Kit (KAPA Biosystems, Mỹ); Luciferase Assay Substrate, Luciferase Assay Buffer, Cell Culture Lysis 5X Reagent (Promega, Mỹ); Dimethyl sulfoxide (DMSO) (Merck, Đức); Thuốc thử TurboFect (Fermentas, Mỹ); Bio-Rad Protein Assay (Bio-Rad, Mỹ), Methanol (Xi Long Scientific, Trung Quốc). TOOLs Easy Fast RT Kit (TOOLs Biotechnology, Đài Loan).

Thiết bị

Tủ an toàn sinh học (Sanxiong Technology, Đài Loan), Máy cô quay chân không RE300 (Stuart, London, Anh), Cân phân tích, Synergy HT Multi-Mode Reader (Bio-Tek Instruments Inc, Mỹ); Tủ ủ NuAire CO 2 (NuAire, Mỹ).

Mẫu dược liệu

Nghiên cứu đã tiến hành thu thập các bộ phận khác nhau từ 24 loài dược liệu/cây thuốc tiềm năng để thực hiện sàng lọc hoạt tính ức chế gen Nrf2. Dược liệu/cây thuốc được nhóm tác giả thu hái các bộ phận dùng tương ứng vào tháng 8/2022, tại tỉnh An Giang. Các mẫu dược liệu được định danh bởi TS. Võ Thanh Hóa. Sau khi thu hái, dược liệu/cây thuốc được sửa sạch, để ráo, sau đó cắt nhỏ và sấy ở 50 °C cho đến khi khô hoàn toàn (độ ẩm dưới 10%). Dược liệu/cây thuốc sau khi khô được xay nhỏ và sàng qua rây 1 mm để thu được bột dược liệu. 20 g bột dược liệu được chiết ngấm kiệt với 180 mL methanol trong 3 ngày, sau đó thu dịch lọc và cô quay chân không để thu cao chiết toàn phần tương ứng với mỗi dược liệu.

Nuôi cấy tế bào và cấy truyền DNA

Tế bào HEK293T, Huh7 được cung cấp bởi Trung tâm nghiên cứu và phát triển thuốc (Drug Development and Value Creation Research Center, Đại học Y Cao Hùng, Đài Loan). Tế bào được nuôi cấy trong môi trường môi trường Eagle sửa đổi của Dulbecco (DMEM) với 10% huyết thanh nhau thai bò đã được bất hoạt bằng nhiệt (FBS), penicillin (100 U/ml), streptomycin (100 μg/ml), L-glutamine (2 mM), và acid amin không thiết yếu (0,1 mM). Tế bào lentivirus để chuyển nạp được nuôi cấy trong DMEM và được bổ sung hygromycin (100 μg/mL) hoặc hỗn hợp gồm puromycin (1 μg/mL) và hygromycin (100 μg/mL). Thuốc thử TurboFect đã được sử dụng để truyền DNA plasmid theo hướng dẫn của nhà sản xuất.

Mô hình xác định hoạt động của Nrf2 trên tế bào Huh7

Real-time PCR định lượng mức độ biểu hiện mRNA của các gen mục tiêu Nrf2

RNA được phân lập bằng cách sử dụng thuốc thử TRIzol và được phiên mã ngược thành cDNA bằng TOOLs Easy Fast RT Kit. qPCR được thực hiện trên ABI StepOne Plus System (Applied Biosystems, Foster City, CA, Mỹ) bằng KAPA SYBR FAST qPCR Master Mix (2X) Kit. Mức mRNA được chuẩn hóa với mức mRNA glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Các đoạn mồi được sử dụng thể hiện tại Table 1 .

Table 1 Trình tự các đoạn mồi được sử dụng trong nghiên cứu

Immunoblot để xác định protein Nrf2

Tế bào được rửa bằng dung dịch đệm PBS, sau đó được thu hoạch bằng cách sử dụng dung dịch đệm ly giải RIPA (50 mM Tris (pH 7,5), 150 mM NaCl, 1mM EDTA, 1% NP-40, 0,1% SDS) và bổ sung chất ức chế protease và phosphatase (chứa 1 mM PMSF, 10 μg/mL Leupeptin, 50 μg/mL TLCK, 50 μg/mL TPCK, 1 μg/mL Aprotinin, 1 mM NaF, 5 mM NaPPi và 10 mM Na₃VO₄). Tế bào sau khi ly giải được ly tâm lạnh ở 4 °C với tốc độ 13.000 vòng/phút trong 15 phút. Nồng độ protein được xác định bằng Bio-Rad Protein Assay (Bio-Rad, Hercules, CA, Mỹ). Các kháng thể được sử dụng bao gồm: anti-NRF2 (GTX103322), anti-GAPDH (60004-1g), anti-KEAP1 (10503-2-AP), và anti-lamin B1 (66095-1-Ig).

Thiết kế plasmid

pGL4.37 [luc2P/ARE/Hygro] (Promega Corporation, Mỹ) được cắt giới hạn bằng enzym SspI và SalI để thu được đoạn Nrf2 reporter 4kB. Plasmid pLKO.1-shLuc (clone#TRCN0000072249) cung cấp bởi National RNAi Core Facility (Academia Sinica, Đài Loan) được cắt giới hạn bằng enzym ClaI và KpnI để tạo đoạn khung chính chứa các yếu tố cần thiết cho quá trình chuyển nạp vào Lentivirus. Quick Blunting Kit (New England Biolabs, Beverly MA, Mỹ) được sử dụng để cắt phần thừa không tương thích ở đầu 5′ hoặc 3′ trong đoạn plasmid theo hướng dẫn của nhà sản xuất. Sau khi ghép 2 đoạn DNA với nhau, thiết lập bản đồ gen và xác định hướng chèn của plasmid bằng enzym cắt giới hạn SspI và EcoRV. Cấu trúc của plasmid thu được là pLV-ARE-Luc_R. Hai plasmid mã hóa các shRNA khác nhau của Nrf2 bao gồm: shNrf2-1 (5'AGTTTGGGAGGAGCTATTATC, clone #: TRCN0000007555) và shNrf2-2 (5'GCTCCTACTGTGATGTGAAAT, clone #: TRCN0000273494); plasmid kiểm soát RNAi (pLKO.1-shSCR); plasmid đóng gói (pCMV-DR8.91); và plasmid vỏ (pMD.G) từ National RNAi Core Facility (Academia Sinica, Đài Loan)

Tạo dòng virus chứa plasmid

Để tạo lentivirus, tế bào HEK293T được đồng chuyển nạp với các plasmid đã thiết kế trước đó sử dụng thuốc thử TurboFect theo hướng dẫn của nhà sản xuất. Các hạt nổi có chứa lentivirus được thu hoạch theo quy trình đã được công bố (http://rnai.genmed.sinica.edu.tw/). Để tạo ra các dòng tế bào ổn định, tế bào Huh7 được nuôi cấy trong môi trường chứa lentivirus và polybrene (8 μg/mL) trong 24 giờ. Các tế bào ổn định sau khi chuyển nạp plasmid được chọn bằng cách nuôi cấy trong môi trường chứa kháng sinh trong 48 giờ.

Kiểm tra khả năng sống của tế bào và hoạt động tương đối của Nrf2

Tế bào Huh7 được gieo trong đĩa 96 giếng (10⁴ tế bào/giếng), sau đó được xử lý với cao chiết nồng độ 100 µg/mL và ủ 18 giờ ở nhiệt độ 37 °C và 5% CO₂. Sau 18 giờ, cao chiết và môi trường được loại bỏ, sau đó thêm vào mỗi giếng 100 µL môi trường nuôi cấy mới và 10 µL Alamarblue (1 mg/mL) sau đó tiếp tục ủ trong 4 giờ. Độ huỳnh quang của resazurin trong alamarblue bị khử được đo ở lớp dung dịch trên của bề mặt nuôi cấy bằng cách sử dụng Synergy HT Multi-Mode Reader và từ đó xác định khả năng sống của tế bào. Sau đó, tế bào được ly giải bằng dung dịch đệm ly giải nhằm thu được protein luciferase. Hoạt động tương đối của Nrf2 trên tế bào Huh7 được xác định bằng cách xác định độ phát huỳnh quang của phản ứng của protein luciferase với luciferin. Giếng đối chứng với DMSO 1% được quy ước là Nrf2 có hoạt tính 100%.

Xử lý số liệu

Kết quả xác định tế bào sống sót và hoạt động của Nrf2 được thu thập bằng phần mềm Gen5. Kết quả thí nghiệm được xử lý bằng phần mềm Microsoft Excel 2016 và GraphPad Prsim 9.5.0. Tất cả dữ liệu được trình bày dưới dạng trung bình ± SD. Mỗi thí nghiệm được lặp lại 3 lần.

Kết quả

Kết quả thiết lập danh mục các loài dược liệu được dân gian sử dụng trong hỗ trợ điều trị ung thư

Table 2 Danh mục 24 loài dược liệu được sử dụng trong hỗ trợ điều trị ung thư theo y học cổ truyền

Mô hình xác định hoạt động của Nrf2 trên tế bào Huh7

Để xây dựng mô hình đánh giá hoạt động của Nrf2 trên tế bào Huh7, chúng tôi đã thiết lập một đọan DNA chứa yếu tố phản ứng oxi hóa (ARE - antioxidant response element), một đoạn gen chỉ thị luciferase Luc2p, gen kháng hygromycrin và một số yếu tố cần thiết khác vào lentivirus pLKO, sau đó chuyển nạp vào tế bào Huh7. Các tế bào Huh7 chuyển nạp thành công được chọn lọc và duy trì trong môi trường chứa hygromycin là các tế bào Huh7/ARE. Luteolin (LuT) được sử dụng làm tác nhân ức chế biểu hiện của Nrf2. Kết quả kiểm tra khả năng sống sót của tế bào trên nhóm đối chứng âm (DMSO) và đối chứng dương (Luteolin) lần lượt là 100±1% và 75±2% ( Figure 1 ). Hoạt động của Nrf2 trên nhóm đối chứng âm DMSO là 100±5% và đối tế bào được xử lý với Luteolin (50 µM) là 17±7%. Kết quả này cho thấy nghiên cứu của chúng tôi đã xây dựng thành công mô hình xác định hoạt động tương đối của gen Nrf2 trên tế bào Huh7 với kết quả tế bào mang gen chuyển nạp có khả năng sống sót và biểu hiện Nrf2 sự ổn định.

Figure 1 . Kết quả xác định khả năng sống sót và hoạt động của Nrf2 trên tế bào Huh7/ARE. DMSO được sử dụng làm đối chứng âm, với hoạt động của Nrf2 trên đối chứng DMSO được xem là 100%. Luteolin được sử dụng làm chất ức chế hoạt động của Nrf2, với nồng độ cuối cùng là 50 mM. Kết quả được thể hiện dưới dạng trung bình ± SD (n = 15).

Kết quả sàng lọc hoạt động của Nrf2 đối với 52 cao chiết từ các bộ phận khác nhau của 24 loài dược liệu

Table 3 Kết quả sàng lọc tác động của 52 cao chiết từ các bộ phận khác nhau của 24 loài dược liệu

Kết quả sàng lọc khả năng ức chế biểu hiện 52 cao chiết methanol từ các bộ phận khác nhau (rễ, lá, thân, quả, thân rễ) của 24 dược liệu được trình bày ở Table 3 . Giá trị hoạt động tương đối của Nrf2 trên tế bào Huh7 (%) được khảo sát với nồng độ cao chiết là 100 µg/mL. Hoạt động tương đối của Nrf2 càng thấp cho thấy khả năng ức chế Nrf2 của cao chiết càng mạnh. Trong số 52 mẫu được khảo sát, rễ Lá lốt cho thấy khả năng ức chế Nrf2 tốt nhất với kết quả hoạt tính của Nrf2 chỉ còn 10,9±2,1% và không gây độc trên tế bào Huh7. Ngoài ra, một số cao chiết từ lá Mật gấu, thân cây Chó đẻ thân xanh, lá Gừng gió, lá và rễ É lớn tròng, lá cây Mật nhân, lá Thần xạ hương, lá An xoa, thân Núc nác, quả Ráy gai và lá Lục lạc cho kết quả ức chế hơn 60% hoạt động của Nrf2 trên tế bào Huh7 ở nồng độ 100 µg/mL. Hầu hết các mẫu cao chiết không gây độc trên tế bào ung thư Huh7, ngoại trừ cao chiết lá Nga truật và lá Thần xạ hương, với phần trăm tế bào sống sót lần lượt là 14,9±13,2 và 28,7±15,9%.

Thảo luận

Hiện nay, việc tác động lên Nrf2 được chia làm hai khuynh hướng: ức chế Nrf2 để khắc phục tình trạng kháng hóa trị hoặc/và kích hoạt Nrf2 để ngăn chặn hình thành ung thư do stress oxy hóa 161 , 162 , 163 . Trong nghiên cứu của chúng tôi, hầu hết các mẫu cao chiết có khả năng gây ức chế Nrf2 trên tế bào Huh7 đều không gây ra độc tính đáng kể lên tế bào, trừ trường hợp lá Nga truật và Lá Thần xạ hương. Trong số các cây ghi nhận khả năng ức chế Nrf2 mạnh trong nghiên cứu, những hợp chất tự nhiên nổi trội được phân lập từ các cây bao gồm những nhóm flavonoid, alkaloid, steroid và tinh dầu ( Table 2 ).

Các thành phần chính trong rễ Lá Lốt được phân lập phần lớn là tinh dầu 34 , alkaloid 33 và một vài hoạt chất flavonoid 35 . Đáng chú ý, tinh dầu asaricin và isoasarone phân lập từ rễ Lá Lốt từng được ghi nhận khả năng tăng tích lũy các gốc oxy hóa và thúc đẩy tín hiệu apoptosis của dòng tế bào ung thư vú ở người (MDA-MB-231) trong nghiên cứu trước đây 43 . Zerumbone là thành phần chính nổi trội trong tinh dầu của cây Gừng Gió. Hoạt chất này được ghi nhận gây ra quá trình chết theo chương trình ở các tế bào ung thư buồng trứng và tử cung 164 . Chó đẻ thân xanh có chứa lượng lớn các alkaloid, flavonoid, ellagitannin, lignan, sterol, và tinh dầu. Alkaloid securinine phân lập từ cây thuộc chi Phyllanthus có tác dụng tích lũy gốc oxy hóa trong tế bào HeLa và kích hoạt các tín hiệu apoptosis của ty thể 165 . Chó đẻ thân xanh được nghiên cứu để điều trị ung thư vú bằng cách làm giảm tiềm năng của màng ty thể, tăng các loại oxy phản ứng nội bào, điều chỉnh tăng biểu hiện caspase-3 và điều chỉnh giảm biểu hiện Bcl-2 166 . Ngoài ra sự hiện diện của acid gallic, gereniin, quercetin và rutin trong cây chó đẻ thân xanh thể hiện khả năng bắt giữ chu kỳ tế bào và điều hòa các tín hiệu phosphoryl hóa gây apoptosis 166 . Flavonoid chrysin phân lập từ Núc nác được chứng minh có khả năng điều chỉnh giảm con đường truyền tín hiệu Nrf2, qua đó làm tăng khả năng nhạy cảm thuốc hóa trị và gây độc trên tế bào BEL-7402 kháng doxorubicin 167 . Các nhóm flavonoid apigetrin, apigenin, luteolin trong cây Mật gấu được ghi nhận chống ung thư trên các tế bào ung thư vú 4T1 thông qua việc gây ra apoptosis, tăng cường tích lũy tế bào trên pha G2/M trong chu kỳ tế bào và ức chế biểu hiện của PI3K và mTOR 168 . Tinh dầu và các alkaloid, flavonoid, tannin, phenolic, và saponin chiết xuất từ cây É lớn tròng được chứng minh là thành phần chính cho thấy hoạt động chống ung thư trên dòng tế bào MCF-7 95 . An xoa, Thần xạ hương được sử dụng trong bài thuốc cổ truyền để điều trị xơ gan, ung thư gan. Các hoạt chất tìm thấy trong cây An Xoa gồm những dẫn xuất của acid betulinic và dẫn xuất của flavonoid isoscutellarein ghi nhận hoạt tính kháng ung thư trung bình trên các dòng tế bào ung thư gan khác nhau 169 . Thần xạ hương được xem là phương thuốc quý trong việc hỗ trợ điều trị các bệnh xơ gan, cổ trướng và hỗ trợ điều trị ung thư theo kinh nghiệm dân gian; tuy nhiên vẫn chưa có nhiều nghiên cứu về tác động dược lý của chúng. Nhìn chung, các dược liệu cho thấy khả năng gây ức chế Nrf2 trên tế bào Huh7 trong nghiên cứu này đều chứa các nhóm hợp chất có tác dụng dược lí đáng lưu tâm, đặc biệt là các flavonoid.

Nghiên cứu của chúng tôi là nghiên cứu đầu tiên tại Việt Nam cho thấy khả năng ức chế hoạt động của Nrf2 trên tế bào Huh7 của cao chiết một số dược liệu Việt Nam. Nghiên cứu cũng đồng thời ghi nhận Nga Truật có khả năng gây độc mạnh trên tế bào Huh7 với phần trăm tế bào sống sót dưới 15% và khả năng ức chế Nrf2 hơn 50%. Bên cạnh khả năng kháng ung thư, hỗ trợ các bệnh lí về gan đã được nghiên cứu trước đây, nghiên cứu này đã chỉ ra khả năng ức chế hoạt động Nrf2 của các loài thực vật trên dòng tế bào Huh7. Điều này cho thấy tiềm năng của cây thuốc trong kìm hãm sự tiến triển của khối u và cải thiện tình trạng kháng thuốc của bệnh ung thư. Đồng thời mở ra hướng kết hợp dược liệu với các loại thuốc hoá trị hiện có để khắc phục tình trạng kháng thuốc 170 . Tuy nhiên, việc ức chế không chọn lọc hoạt động của Nrf2 có thể gây tác dụng phụ không mong muốn trên cơ thể của bệnh nhân ung thư vì điều này có thể làm giảm hiệu quả của hàng rào bảo vệ tự nhiên của bệnh nhân với thuốc hóa trị trên các tế bào thường 171 . Vì vậy cần có nhiều nghiên cứu hơn nữa về hoạt tính của dược liệu liên quan đến cơ chế tác động trên Nrf2 của cả tế bào ung thư và các dòng tế bào thường.

Kết luận

Lần đầu tiên tại Việt Nam đã nghiên cứu sàng lọc hoạt tính ức chế biểu hiện Nrf2 trên tế bào ung thư gan Huh7 của 52 cao chiết bằng methanol từ các bộ phận khác nhau như: thân, lá, rễ, thân rễ của 24 dược liệu/cây thuốc vốn được sử dụng trong dân gian và y học cổ truyền để hỗ trợ điều trị ung thư. Rễ lá lốt cho thấy khả năng ức chế Nrf2 trên tế bào ung thư gan Huh7 mạnh lên đến 90%. Cao chiết lá Mật gấu, thân cây Chó đẻ thân xanh, lá Gừng gió, lá và rễ É lớn tròng, lá cây Mật nhân, lá Thần xạ hương, lá An xoa, thân Núc nác, quả Ráy gai và lá Lục lạc cũng ức chế Nrf2 dưới 40% khả năng hoạt động trên tế bào Huh7. Ngoài ra, chúng tôi còn ghi nhận cao methanol lá Thần xạ hương và á Nga truật có khả năng gây độc tế bào ung thư hơn 70%. Những phát hiện này là cơ sở để chúng tôi thực hiện các nghiên cứu sâu hơn về cơ chế tác động cũng như tìm ra các hoạt chất thiên nhiên có tác động đảo ngược tình trạng kháng thuốc điều trị thông qua việc ức chế biểu hiện của Nrf2 trên tế bào ung thư.

Lời cảm ơn

Nghiên cứu này được tài trợ bởi Đại học Quốc gia Thành phố Hồ Chí Minh trong khuôn khổ đề tài mã số B2023-44-01.

Danh mục từ viết tắt

DMEM: Môi trường Dullbecco có sửa biến đổi (Dulbecco’s Modified Eagle’s Medium)

FBS: Huyết thanh nhau thai bò đã được bất hoạt bằng nhiệt (heat-inactivated fetal bovine serum)

Huh7: dòng tế bào ung thư biểu mô tế bào gan Huh7 (Huh-7 human hepatocellular carcinoma cells)

Nrf2: Nuclear factor erythroid-2 p45-related factor 2

PCR: Phản ứng chuỗi polymerase (Polymerase-Chain-Reaction)

Xung đột lợi ích

Nhóm tác giả cam kết rằng không có xung đột lợi ích khi thực hiện nghiên cứu này.

Đóng góp của các tác giả

Tác giả Nguyễn Minh Hiền đưa ra ý tưởng và thiết kế thí nghiệm. Các tác giả Lê Nguyễn Thiên Hân, Nguyễn Thị Yến Nhi và Nguyễn Minh Hiền tiến hành thu thập mẫu, thực hiện thí nghiệm, thu thập, phân tích và xử lý số liệu. Tác giả Chia-Hung Yen hướng dẫn và hỗ trợ các thí nghiệm liên quan đến tế bào. Các tác giả Nguyễn Minh Hiền, Lê Nguyễn Thiên Hân, Nguyễn Thị Yến Nhi, Võ Thanh Hóa, Phạm Tấn Thi và Chia-Hung Yen tham gia viết bản thảo và chỉnh sửa nội dung bản thảo. Tất cả các tác giả đã đọc và duyệt bản thảo cuối cùng.

References

  1. National Cancer Institute. What is Cancer? 2021 [updated 2021 October 11th; cited 2023 May 15th]. . ;:. Google Scholar
  2. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer Journal for Clinicians. 2021;71(3):209-249. . ;:. Google Scholar
  3. Wilson BE, Jacob S, Yap ML, Ferlay J, Bray F, Barton MB. Estimates of global chemotherapy demands and corresponding physician workforce requirements for 2018 and 2040: a population-based study. The Lancet Oncology. 2019;20(6):769-780. . ;:. Google Scholar
  4. Pinedo HM, Giaccone G. Drug resistance in the treatment of cancer: Cambridge University Press; 1998. . ;:. Google Scholar
  5. Fojo T, Parkinson DR. Biologically targeted cancer therapy and marginal benefits: are we making too much of too little or are we achieving too little by giving too much? Clinical Cancer Research. 2010;16(24):5972-5980. . ;:. PubMed Google Scholar
  6. Bukowski K, Kciuk M, Kontek R. Mechanisms of multidrug resistance in cancer chemotherapy. International journal of molecular sciences. 2020;21(9):3233-3256. . ;:. Google Scholar
  7. Rosa R, Monteleone F, Zambrano N, Bianco R. In Vitro and In Vivo Models for Analysis of Resistance to Anticancer Molecular Therapies. Current Medicinal Chemistry. 2014;21(14):1595-1606. . ;:. Google Scholar
  8. Ghoneum A, Said N. PI3K-AKT-mTOR and NFκB pathways in ovarian cancer: implications for targeted therapeutics. Cancers. 2019;11(7):949-974. . ;:. Google Scholar
  9. Shaul YD, Seger R. The MEK/ERK cascade: from signaling specificity to diverse functions. Biochimica et Biophysica Acta -Molecular Cell Research. 2007;1773(8):1213-1226. . ;:. Google Scholar
  10. Boussommier-Calleja A. In vitro models of cancer. Bioengineering Innovative Solutions for Cancer: Elsevier; 2020. p. 273-325. . ;:. Google Scholar
  11. Sporn MB, Liby KT. Nrf2 and cancer: the good, the bad and the importance of context. Nature Reviews Cancer. 2012;12(8):564-571. . ;:. Google Scholar
  12. Tao S, Park SL, de la Vega MR, Zhang DD, Wondrak GT. Systemic administration of the apocarotenoid bixin protects skin against solar UV-induced damage through activation of Nrf2. Free Radical Biology and Medicine. 2015;89:690-700. . ;:. Google Scholar
  13. Tao S, Rojo de la Vega M, Chapman E, Ooi A, Zhang DD. The effects of Nrf2 modulation on the initiation and progression of chemically and genetically induced lung cancer. Molecular Carcinogenesis. 2018;57(2):182-192. . ;:. Google Scholar
  14. Lignitto L, LeBoeuf SE, Homer H, Jiang S, Askenazi M, Karakousi TR, et al. Nrf2 activation promotes lung cancer metastasis by inhibiting the degradation of Bach1. Cell. 2019;178(2):316-329. e318. . ;:. Google Scholar
  15. Zhang C, Wang H-J, Bao Q-C, Wang L, Guo T-K, Chen W-L, et al. NRF2 promotes breast cancer cell proliferation and metastasis by increasing RhoA/ROCK pathway signal transduction. Oncotarget. 2016;7(45):73593-73606. . ;:. Google Scholar
  16. Cucci MA, Grattarola M, Dianzani C, Damia G, Ricci F, Roetto A, et al. Ailanthone increases oxidative stress in CDDP-resistant ovarian and bladder cancer cells by inhibiting of Nrf2 and YAP expression through a post-translational mechanism. Free Radical Biology and Medicine. 2020;150:125-135. . ;:. Google Scholar
  17. Harder B, Tian W, La Clair JJ, Tan AC, Ooi A, Chapman E, et al. Brusatol overcomes chemoresistance through inhibition of protein translation. Molecular Carcinogenesis. 2017;56(5):1493-1500. . ;:. Google Scholar
  18. Tarumoto T, Nagai T, Ohmine K, Miyoshi T, Nakamura M, Kondo T, et al. Ascorbic acid restores sensitivity to imatinib via suppression of Nrf2-dependent gene expression in the imatinib-resistant cell line. Experimental Hematology. 2004;32(4):375-381. . ;:. Google Scholar
  19. Gao A-M, Ke Z-P, Wang J-N, Yang J-Y, Chen S-Y, Chen H. Apigenin sensitizes doxorubicin-resistant hepatocellular carcinoma BEL-7402/ADM cells to doxorubicin via inhibiting PI3K/Akt/Nrf2 pathway. Carcinogenesis. 2013;34(8):1806-1814. . ;:. Google Scholar
  20. Li D, Hong X, Zhao F, Ci X, Zhang S. Targeting Nrf2 may reverse the drug resistance in ovarian cancer. Cancer Cell International. 2021;21(1):1-10. . ;:. Google Scholar
  21. Wang P, Yang HL, Yang YJ, Wang L, Lee SC. Overcome cancer cell drug resistance using natural products. Evidence-Based Complementary and Alternative Medicine. 2015;2015:1-14. . ;:. Google Scholar
  22. Zuo Y, Zhang C-z, Ren Q, Chen Y, Li X, Yang J-r, et al. Activation of mitochondrial-associated apoptosis signaling pathway and inhibition of PI3K/Akt/mTOR signaling pathway by voacamine suppress breast cancer progression. Phytomedicine. 2022;99:154015. . ;:. Google Scholar
  23. Jucá MM, Cysne Filho FMS, de Almeida JC, Mesquita DdS, Barriga JRdM, Dias KCF, et al. Flavonoids: biological activities and therapeutic potential. Natural Product Research. 2020;34(5):692-705. . ;:. Google Scholar
  24. Ferreira A, Rodrigues M, Fortuna A, Falcão A, Alves G. Flavonoid compounds as reversing agents of the P-glycoprotein-mediated multidrug resistance: An in vitro evaluation with focus on antiepileptic drugs. Food Research International. 2018;103:110-120. . ;:. Google Scholar
  25. Ye Q, Liu K, Shen Q, Li Q, Hao J, Han F, et al. Reversal of multidrug resistance in cancer by multi-functional flavonoids. Frontiers in Oncology. 2019;9:487-502. . ;:. Google Scholar
  26. Tang X, Wang H, Fan L, Wu X, Xin A, Ren H, et al. Luteolin inhibits Nrf2 leading to negative regulation of the Nrf2/ARE pathway and sensitization of human lung carcinoma A549 cells to therapeutic drugs. Free Radical Biology and Medicine. 2011;50(11):1599-1609. . ;:. Google Scholar
  27. Chian S, Thapa R, Chi Z, Wang XJ, Tang X. Luteolin inhibits the Nrf2 signaling pathway and tumor growth in vivo. Biochemical and Biophysical Research Communications. 2014;447(4):602-608. . ;:. Google Scholar
  28. Tang S-N, Singh C, Nall D, Meeker D, Shankar S, Srivastava RK. The dietary bioflavonoid quercetin synergizes with epigallocathechin gallate (EGCG) to inhibit prostate cancer stem cell characteristics, invasion, migration and epithelial-mesenchymal transition. Journal of Molecular Signaling. 2010;5(1):1-15. . ;:. Google Scholar
  29. Nautiyal J, Kanwar SS, Yu Y, Majumdar AP. Combination of dasatinib and curcumin eliminates chemo-resistant colon cancer cells. Journal of Molecular Signaling. 2011;6(1):1-11. . ;:. Google Scholar
  30. Kakarala M, Brenner DE, Korkaya H, Cheng C, Tazi K, Ginestier C, et al. Targeting breast stem cells with the cancer preventive compounds curcumin and piperine. Breast Cancer Research and Treatment. 2010;122:777-785. . ;:. Google Scholar
  31. Hossain MM, Banik NL, Ray SK. Synergistic anti-cancer mechanisms of curcumin and paclitaxel for growth inhibition of human brain tumor stem cells and LN18 and U138MG cells. Neurochemistry International. 2012;61(7):1102-1113. . ;:. Google Scholar
  32. Nguyen PH, Luu DC, Nguyen QB. A survey of traditional medicinal plants used by K'ho people in the buffer zone of Chu Yang Sin national park, Vietnam. Journal of Vietnamese Environment. 2014;6(3):276-280. . ;:. Google Scholar
  33. Nguyen HM, Nguyen NYT, Chau NTN, Nguyen ABT, Tran VKT, Hoang V, et al. Bioassay-guided discovery of potential partial extracts with cytotoxic effects on liver cancer cells from vietnamese medicinal herbs. Processes. 2021;9(11):1956. . ;:. Google Scholar
  34. Poonkodi K, Karthika J, Tamilselvi V, Anitha R, Vasanthamani S. Chemical composition of essential oil of Hyptis suaveolens (L) Poit and its invitro anticancer activity. Journal of Pharmacy Research. 2017;11(5):410-413. . ;:. Google Scholar
  35. Estai MA, Suhaimi F, Shuid AN, Das S, Abdullah S, Soelaiman I-N. Biomechanical evaluation of fracture healing following administration of Piper sarmentosum in ovariectomised rats. African Journal of Pharmacy and Pharmacology. 2012;6(3):144-147. . ;:. Google Scholar
  36. Syed-Ab-Rahman SF, Omar D. Development of bio-formulations of Piper sarmentosum extracts against bacterial rice diseases. Current Biotechnology. 2018;7(6):453-463. . ;:. Google Scholar
  37. Lee J, Cho S, Paik H, Choi C, Nam K, Hwang S, et al. Investigation on antibacterial and antioxidant activities, phenolic and flavonoid contents of some Thai edible plants as an alternative for antibiotics. Asian-Australasian Journal of Animal Sciences (AJAS). 2014;27(10):1461-1468. . ;:. Google Scholar
  38. Yeo ETY, Wong KWL, See ML, Wong KY, Gan SY, Chan EWL. Piper sarmentosum Roxb. confers neuroprotection on beta-amyloid (Aβ)-induced microglia-mediated neuroinflammation and attenuates tau hyperphosphorylation in SH-SY5Y cells. Journal of Ethnopharmacology. 2018;217:187-194. . ;:. Google Scholar
  39. Li Q, Qu F-L, Gao Y, Jiang Y-P, Rahman K, Lee K-H, et al. Piper sarmentosum Roxb. produces antidepressant-like effects in rodents, associated with activation of the CREB-BDNF-ERK signaling pathway and reversal of HPA axis hyperactivity. Journal of Ethnopharmacology. 2017;199:9-19. . ;:. Google Scholar
  40. Ugusman A, Zakaria Z, Hui CK, Megat Mohd Nordin NA. Piper sarmentosum inhibits ICAM-1 and Nox4 gene expression in oxidative stress-induced human umbilical vein endothelial cells. BMC Complementary Medicine and Therapies. 2011;11(1):1-8. . ;:. Google Scholar
  41. Krisanapun C, Wongkrajang Y, Temsiririrkkul R, Phornchirasilp S, Peungvicha P. In vitro evaluation of anti‐diabetic potential of Piper sarmentosum Roxb. extract. Wiley Online Library; 2012. . ;:. Google Scholar
  42. Hematpoor A, Paydar M, Liew SY, Sivasothy Y, Mohebali N, Looi CY, et al. Phenylpropanoids isolated from Piper sarmentosum Roxb. induce apoptosis in breast cancer cells through reactive oxygen species and mitochondrial-dependent pathways. Chemico-biological interactions. 2018;279:210-218. . ;:. Google Scholar
  43. Yong Y, Matthew S, Wittwer J, Pan L, Shen Q, Kinghorn AD, et al. Dichamanetin inhibits cancer cell growth by affecting ROS-related signaling components through mitochondrial-mediated apoptosis. Anticancer Research. 2013;33(12):5349-5355. . ;:. Google Scholar
  44. Bộ Y Tế. Dược điển Việt Nam V. Hà Nội: Nhà xuất bản Y học; 2018. . ;:. Google Scholar
  45. Đỗ Tất Lợi. Những Cây thuốc và Vị thuốc Việt Nam. Hà Nội: Nhà xuất bản Y học; 2004. . ;:. Google Scholar
  46. Traore F, Faure R, Ollivier E, Gasquet M, Azas N, Debrauwer L, et al. Structure and antiprotozoal activity of triterpenoid saponins from Glinus oppositifolius. Planta Medica. 2000;66(04):368-371. . ;:. Google Scholar
  47. Sahakitpichan P, Disadee W, Ruchirawat S, Kanchanapoom T. L-(−)-(N-trans-Cinnamoyl)-arginine, an Acylamino Acid from Glinus oppositifolius (L.) Aug. DC. Molecules. 2010;15(9):6186-6192. . ;:. Google Scholar
  48. Martin-Puzon JJR, Valle Jr DL, Rivera WL. TLC profiles and antibacterial activity of Glinus oppositifolius L. Aug. DC.(Molluginaceae) leaf and stem extracts against bacterial pathogens. Asian Pacific Journal of Tropical Disease. 2015;5(7):569-574. . ;:. Google Scholar
  49. Zhang D, Fu Y, Yang J, Li X-N, San MM, Oo TN, et al. Triterpenoids and their glycosides from Glinus oppositifolius with antifungal activities against Microsporum gypseum and Trichophyton rubrum. Molecules. 2019;24(12):2206-2228. . ;:. Google Scholar
  50. Hoque N, Habib RM, Imam MZ, Ahmed J, Rana SM. Analgesic and anti-inflammatory potential of methanolic extract of Glinus oppositifolius L. Australian Journal of Basic and Applied Sciences. 2011;5(8):729-733. . ;:. Google Scholar
  51. Behera GM, Satish Kumar B, Malay Baidya M, Panigrahi G. Antihyperglycemic, antihyperlipidemic and antioxidant activity of Glinus oppositifolius (L.) Aug. DC. Pharmacologyonline. 2010;3:915-936. . ;:. Google Scholar
  52. Panigrahi G, Mishra U, Mahapatra S, Panda C, Pasa G, Hati D. Hypoglycemic and hypolipidemic activities of methanolic extract of Glinus oppositifolius. International Journal of Pharmacy. 2012;2(3):491-497. . ;:. Google Scholar
  53. Natarajan P, Thirupathi AT, Sekharan TR, Sundar A, Arivukkarasu R, Ganesan M. Hepatoprotective effect of Glinus oppositifolius Linn. Research Journal of Pharmacology and Pharmacodynamics. 2010;2(4):289-292. . ;:. Google Scholar
  54. Oladunmoye M, Afolami O, Oladejo B, Amoo I, Osho B. Identification and Quantification of Bioactive Compounds Present in the Plant Vernonia amygdalina Delile using GC-MS Technique. Natural Products Chemistry & Research. 2019;7(356):1-5. . ;:. Google Scholar
  55. Ogunbinu AO, Flamini G, Cioni PL, Ogunwande IA, Okeniyi SO. Essential oil constituents of Eclipta prostrata (L.) L. and Vernonia amygdalina Delile. Natural Product Communications. 2009;4(3):1934578X0900400321. . ;:. Google Scholar
  56. Johnson W, Tchounwou PB, Yedjou CG. Therapeutic Mechanisms of Vernonia amygdalina Delile in the Treatment of Prostate Cancer. Molecules. 2017;22(10):1594-1606. . ;:. Google Scholar
  57. Yedjou CG, Sims JN, Njiki S, Tsabang N, Ogungbe IV, Tchounwou PB. Vernonia amygdalina Delile exhibits a potential for the treatment of acute promyelocytic leukemia. Global journal of advanced engineering technologies and sciences. 2018;5(8):1-9. . ;:. Google Scholar
  58. Asante D-B, Effah-Yeboah E, Barnes P, Abban HA, Ameyaw EO, Boampong JN, et al. Antidiabetic effect of young and old ethanolic leaf extracts of Vernonia amygdalina: A comparative study. Journal of Diabetes Research. 2016;2016. . ;:. Google Scholar
  59. Asante D-B, Henneh IT, Acheampong DO, Kyei F, Adokoh CK, Ofori EG, et al. Anti-inflammatory, anti-nociceptive and antipyretic activity of young and old leaves of Vernonia amygdalina. Biomedicine and Pharmacotherapy. 2019;111:1187-1203. . ;:. Google Scholar
  60. Iwo MI, Sjahlim SL, Rahmawati SF. Effect of Vernonia amygdalina Del. leaf ethanolic extract on intoxicated male Wistar rats liver. Scientia Pharmaceutica. 2017;85(2):16. . ;:. Google Scholar
  61. Adesanoye OA, Molehin OR, Delima AA, Adefegha AS, Farombi EO. Modulatory effect of methanolic extract of Vernonia amygdalina (MEVA) on tert‐butyl hydroperoxide-induced erythrocyte haemolysis. Cell Biochemistry and Function. 2013;31(7):545-550. . ;:. Google Scholar
  62. Abebe W. Traditional pharmaceutical practice in gondar region, northwestern Ethiopia. Journal of Ethnopharmacology. 1984;11(1):33-47. . ;:. Google Scholar
  63. Siew Y-Y, Yew H-C, Neo S-Y, Seow S-V, Lew S-M, Lim S-W, et al. Evaluation of anti-proliferative activity of medicinal plants used in Asian Traditional Medicine to treat cancer. Journal of Ethnopharmacology. 2019;235:75-87. . ;:. Google Scholar
  64. Al-Reza SM, Rahman A, Sattar M, Rahman MO, Fida HM. Essential oil composition and antioxidant activities of Curcuma aromatica Salisb. Food and Chemical Toxicology. 2010;48(6):1757-1760. . ;:. Google Scholar
  65. Xiang H, Zhang L, Yang Z, Chen F, Zheng X, Liu X. Chemical compositions, antioxidative, antimicrobial, anti-inflammatory and antitumor activities of Curcuma aromatica Salisb. essential oils. Industrial Crops and Products. 2017;108:6-16. . ;:. Google Scholar
  66. Pabuprapap W, Nakyai W, Chaichompoo W, Pheedee N, Phetkeereerat S, Viyoch J, et al. Curcuma aromatica and Curcuma comosa extracts and isolated constituents provide protection against UVB-induced damage and attenuate matrix metalloproteinase-1 expression in HaCaT cells. Cosmetics. 2022;9(1):23. . ;:. Google Scholar
  67. Lim J, Nguyen TTH, Pal K, Kang CG, Park C, Kim SW, et al. Phytochemical properties and functional characteristics of wild turmeric (Curcuma aromatica) fermented with Rhizopus oligosporus. Food Chemistry: X. 2022;13:100198. . ;:. Google Scholar
  68. Li Y, Feng J, Mo Y, Liu H, Yang B. Concordance between cardio-protective effect on isoproterenol-induced acute myocardial ischemia and phenolic content of different extracts of Curcuma aromatica. Pharmaceutical Biology. 2016;54(12):3226-3231. . ;:. Google Scholar
  69. Fei C, Ji D, Tong H, Li Y, Su L, Qin Y, et al. Therapeutic mechanism of Curcuma aromatica Salisb. rhizome against coronary heart disease based on integrated network pharmacology, pharmacological evaluation and lipidomics. Frontiers in Pharmacology. 2022;13. . ;:. PubMed Google Scholar
  70. Kim H, Hong J, Lee J, Jeon W, Yeo C, Lee Y, et al. Curcuma aromatica Salisb. Protects from Acetaminophen-Induced Hepatotoxicity by Regulating the Sirt1/HO-1 Signaling Pathway. Nutrients. 2023;15(4):808. . ;:. PubMed Google Scholar
  71. Xiang H, Zhang L, Xi L, Yang Y, Wang X, Lei D, et al. Phytochemical profiles and bioactivities of essential oils extracted from seven Curcuma herbs. Industrial Crops and Products. 2018;111:298-305. . ;:. Google Scholar
  72. Liu F, Liang Y, Sun R, Yang W, Liang Z, Gu J, et al. Astragalus mongholicus Bunge and Curcuma aromatica Salisb. inhibits liver metastasis of colon cancer by regulating EMT via the CXCL8/CXCR2 axis and PI3K/AKT/mTOR signaling pathway. Chinese Medicine. 2022;17(1):91. . ;:. Google Scholar
  73. Liang ZQ, Bian Y, Gu JF, Yin G, Sun RL, Liang Y, et al. Exploring the anti-metastatic effects of Astragalus mongholicus Bunge-Curcuma aromatica Salisb. on colorectal cancer: A network-based metabolomics and pharmacology approach. Phytomedicine. 2023;114:154772. . ;:. Google Scholar
  74. Sikha A, Harini A. Pharmacological activities of wild turmeric (Curcuma aromatica Salisb): a review. Journal of Pharmacognosy and Phytochemistry. 2015;3(5):01-04. . ;:. Google Scholar
  75. Liu B, Gao Y-Q, Wang X-M, Wang Y-C, Fu L-Q. Germacrone inhibits the proliferation of glioma cells by promoting apoptosis and inducing cell cycle arrest. Molecular medicine reports. 2014;10(2):1046-1050. . ;:. Google Scholar
  76. Patel JR, Tripathi P, Sharma V, Chauhan NS, Dixit VKJJoe. Phyllanthus amarus: ethnomedicinal uses, phytochemistry and pharmacology: a review. 2011;138(2):286-313. . ;:. Google Scholar
  77. Ribeiro AMB, de Sousa JN, Costa LM, de Alcântara Oliveira FA, Dos Santos RC, Nunes ASS, et al. Antimicrobial activity of Phyllanthus amarus Schumach. & Thonn and inhibition of the NorA efflux pump of Staphylococcus aureus by Phyllanthin. Microbial Pathogenesis. 2019;130:242-246. . ;:. Google Scholar
  78. Harikrishnan H, Jantan I, Haque M, Kumolosasi E. Anti-inflammatory effects of Phyllanthus amarus Schum. & Thonn. through inhibition of NF-κB, MAPK, and PI3K-Akt signaling pathways in LPS-induced human macrophages. BMC Complementary Medicine and Therapies. 2018;18(1):1-13. . ;:. Google Scholar
  79. Ahmad S, Bano S, Anwar S. Cancer ameliorating potential of Phyllanthus amarus: In vivo and in vitro studies against Aflatoxin B1 toxicity. Egyptian Journal of Medical Human Genetics. 2015;16(4):343-353. . ;:. Google Scholar
  80. Oyeleye SI, Olasehinde TA, Fasakin OW, Oboh G, Saliu JA-JJPP. Phyllanthus amarus Schumach. & Thonn. and Momordica charantia L extracts improve memory function, attenuate cholinergic and purinergic dysfunction, and suppress oxidative stress in the brain of doxorubicin-treated rats. Phytomedicine Plus. 2022;2(2):100283. . ;:. Google Scholar
  81. Bose Mazumdar Ghosh A, Banerjee A, Chattopadhyay S. An insight into the potent medicinal plant Phyllanthus amarus Schum. and Thonn. The Nucleus. 2022:1-36. . ;:. Google Scholar
  82. Ilangkovan M, Jantan I, Bukhari SNA. Phyllanthin from Phyllanthus amarus inhibits cellular and humoral immune responses in Balb/C mice. Phytomedicine. 2016;23(12):1441-1450. . ;:. Google Scholar
  83. Ghane S, Attar U, Yadav P, Lekhak M. Antioxidant, anti-diabetic, acetylcholinesterase inhibitory potential and estimation of alkaloids (lycorine and galanthamine) from Crinum species: An important source of anticancer and anti-Alzheimer drug. Industrial Crops and Products. 2018;125:168-177. . ;:. Google Scholar
  84. Mahomoodally M, Sadeer N, Suroowan S, Jugreet S, Lobine D, Rengasamy K. Ethnomedicinal, phytochemistry, toxicity and pharmacological benefits of poison bulb-Crinum asiaticum L. South African Journal of Botany. 2021;136:16-29. . ;:. Google Scholar
  85. Jeong YJ, Sohn E-H, Jung Y-H, Yoon W-J, Cho YM, Kim I, et al. Anti-obesity effect of Crinum asiaticum var. japonicum Baker extract in high-fat diet-induced and monogenic obese mice. Biomedicine & Pharmacotherapy. 2016;82:35-43. . ;:. Google Scholar
  86. Adewusi EA, Steenkamp V. In vitro screening for acetylcholinesterase inhibition and antioxidant activity of medicinal plants from southern Africa. Asian Pacific Journal of Tropical Medicine. 2011;4(10):829-835. . ;:. Google Scholar
  87. Pham LH, Döpke W, Wagner J, Mügge C. Alkaloids from Crinum amabile. Phytochemistry. 1998;48(2):371-376. . ;:. Google Scholar
  88. Padalia RC, Verma RS, Chauhan A, Singh VR, Goswami P, Singh S, et al. Zingiber zerumbet (L.) Roscoe ex Sm. from northern India: Potential source of zerumbone rich essential oil for antiproliferative and antibacterial applications. Industrial Crops and Products. 2018;112:749-754. . ;:. Google Scholar
  89. Sidahmed HMA, Hashim NM, Abdulla MA, Ali HM, Mohan S, Abdelwahab SI, et al. Antisecretory, gastroprotective, antioxidant and anti-Helicobcter pylori activity of zerumbone from Zingiber zerumbet (L.) Smith. PloS one. 2015;10(3):e0121060. . ;:. Google Scholar
  90. Koga AY, Beltrame FL, Pereira AV. Several aspects of Zingiber zerumbet: a review. Revista Brasileira de Farmacognosia. 2016;26:385-391. . ;:. Google Scholar
  91. Asha D, Mathew L, Rishad K. Evaluation of HPTLC fingerprints of flavonoids and antioxidant activity of selected medicinal plants of Lamiaceae Family. International Journal of Pharmacognosy and Phytochemical Research. 2015;7(2):240-245. . ;:. Google Scholar
  92. Edeoga H, Omosun G, Uche L. Chemical composition of Hyptis suaveolens and Ocimum gratissimum hybrids from Nigeria. African journal of Biotechnology. 2006;5(10). . ;:. Google Scholar
  93. Mishra P, Sohrab S, Mishra SK. A review on the phytochemical and pharmacological properties of Hyptis suaveolens (L.) Poit. Future Journal of Pharmaceutical Sciences. 2021;7(1):1-11. . ;:. Google Scholar
  94. Martha Perez Gutierrez R, Maria Neira Gonzalez A, Hoyo-Vadillo C. Alkaloids from piper: a review of its phytochemistry and pharmacology. Mini Reviews in Medicinal Chemistry. 2013;13(2):163-193. . ;:. Google Scholar
  95. Masuda T, Inazumi A, Yamada Y, Padolina WG, Kikuzaki H, Nakatani N. Antimicrobial phenylpropanoids from Piper sarmentosum. Phytochemistry. 1991;30(10):3227-3228. . ;:. Google Scholar
  96. Võ Văn Chi. Cây thuốc An Giang. Ủy ban Khoa học - Kỹ thuật An Giang: An Giang; 1991. . ;:. Google Scholar
  97. Liu Y, Bi Y-m, Pan T, Zeng T, Mo C, Sun B, et al. Ethyl acetate fraction of Dicliptera chinensis (L.) Juss. ameliorates liver fibrosis by inducing autophagy via PI3K/AKT/mTOR/p70S6K signaling pathway. Chinese Journal of Integrative Medicine. 2022;28(1):60-68. . ;:. PubMed Google Scholar
  98. Xu Q, Xu J, Zhang K, Zhong M, Cao H, Wei R, et al. Study on the protective effect and mechanism of Dicliptera chinensis (L.) Juss (Acanthaceae) polysaccharide on immune liver injury induced by LPS. Biomedicine & Pharmacotherapy. 2021;134:111159. . ;:. Google Scholar
  99. Zhang K, Gao Y, Zhong M, Xu Y, Li J, Chen Y, et al. Hepatoprotective effects of Dicliptera chinensis polysaccharides on dimethylnitrosamine-induced hepatic fibrosis rats and its underlying mechanism. Journal of ethnopharmacology. 2016;179:38-44. . ;:. Google Scholar
  100. Xu Y, Gao Y, Zhong M, Li J, Cao H, Huang S, et al. Isolation, characterization and bioactivities of the polysaccharides from Dicliptera chinensis (L.) Juss. International Journal of Biological Macromolecules. 2017;101:603-611. . ;:. Google Scholar
  101. Zhang K, Xu Q, Gao Y, Cao H, Lian Y, Li Z, et al. Polysaccharides from Dicliptera chinensis ameliorate liver disturbance by regulating TLR‐4/NF‐κB and AMPK/Nrf2 signalling pathways. Journal of Cellular and Molecular Medicine. 2020;24(11):6397-6409. . ;:. Google Scholar
  102. Jadhao A, Bhuktar A. Phytochemical screening of rhizome extract of Curcuma zedoaria (Christm) Roscoe by HRLC-MS technique. International Journal of Life Sciences. 2019(Special Issue A13):53-57. . ;:. Google Scholar
  103. Chen C-c, Chen Y, Hsi Y-T, Chang C-S, Huang L-F, Ho C-T, et al. Chemical constituents and anticancer activity of Curcuma zedoaria roscoe essential oil against non-small cell lung carcinoma cells in vitro and in vivo. Journal of Agricultural and Food Chemistry. 2013;61(47):11418-11427. . ;:. PubMed Google Scholar
  104. Gharge S, Hiremath SI, Kagawad P, Jivaje K, Palled MS, Suryawanshi SS. Curcuma zedoaria Rosc (Zingiberaceae): a review on its chemical, pharmacological and biological activities. Future Journal of Pharmaceutical Sciences. 2021;7(1):1-9. . ;:. Google Scholar
  105. Mohamad M, Ali MW, Ripin A, Ahmad A. Effect of extraction process parameters on the yield of bioactive compounds from the roots of Eurycoma longifolia. Jurnal Teknologi. 2013;60(1):51â€"57-51â€"57. . ;:. Google Scholar
  106. Rehman SU, Choe K, Yoo HH. Review on a traditional herbal medicine, Eurycoma longifolia Jack (Tongkat Ali): its traditional uses, chemistry, evidence-based pharmacology and toxicology. Molecules. 2016;21(3):331. . ;:. Google Scholar
  107. Yousafa Z, Wanga Y, Baydounc E. Phytochemistry and pharmacological studies on Solanum torvum Swartz. Journal of Applied Pharmaceutical Science. 2013;3(4):152-160. . ;:. Google Scholar
  108. Lu Y, Luo J, Huang X, Kong L. Four new steroidal glycosides from Solanum torvum and their cytotoxic activities. Steroids. 2009;74(1):95-101. . ;:. PubMed Google Scholar
  109. Đỗ Huy Bích, Đặng Quang Chung, Bùi Xuân Chương, Nguyễn Thượng Dong, Đỗ Trung Đàm, Phạm Văn Hiển, et al. Cây thuốc và động vật làm thuốc ở Việt Nam. Hà Nội: Nhà xuất bản Khoa học và Kỹ thuật; 2006. . ;:. Google Scholar
  110. Siemonsma J, Piluek K. Plant resources of south-east Asia. No. 8: Vegetables. 1993. . ;:. Google Scholar
  111. Zhu Z, Gao L, Wang J. Illustrated handbook for medicinal materials from nature in Yunnan (Vol. 2). Yunnan Science and Technology Press: Kunming. 2003;121. . ;:. Google Scholar
  112. Susanti D, Sirat HM, Ahmad F, Ali RMJJIF. Bioactive constituents from the leaves of Melastoma malabathricum L. 2008;5. . ;:. Google Scholar
  113. Joffry S, Yob N, Rofiee M, MeorMohd M, Affandi M, Suhaili Z, et al. Melastoma malabathricum (L.) smith ethnomedicinal uses, chemical constituents, and pharmacological properties: A Review. Evidence-Based Complementary and Alternative Medicine. 2012. . ;:. PubMed Google Scholar
  114. Al-Zikri PNH, Taher M, Susanti D, Rezali MF, Read RW, Sohrab M, et al. Cytotoxic tirucallane triterpenes from the stem of Luvunga scandens. Revista Brasileira de Farmacognosia. 2014;24:561-564. . ;:. Google Scholar
  115. Sirinuta P, Awanwee P, Panumart T, editors. Biological activities of stem extracts from Luvunga scandens. The 5th International conference on Natural products for Health and Beauty Thailand; 2014. . ;:. Google Scholar
  116. Junejo JA, Zaman K, Rudrapal M, Mondal P, Singh KD, Verma VK. Preliminary phytochemical and physicochemical evaluation of Carallia brachiata (Lour.) Merr. leaves. Journal of Applied Pharmaceutical Science. 2014;4(12):123-127. . ;:. Google Scholar
  117. Islam MA, Hossain MS, Azad M, Rashid MH-O, Mofizur M. In vivo evaluation of analgesic, antiinflammatory and antidiabetic activities of methanol extract of Carallia brachiata L. leaves. PharmacologyOnline. 2020;1:38-46. . ;:. Google Scholar
  118. Chularojmontri L, Nanna U, Kaewamatawong R, Homhual S, Suwannaloet W. Inhibitory Effect of Carallia Brachiata Extract Through Regulation of Adipogenesis Pathways in 3T3-L1 Cells. Pharmacognosy Journal. 2022;14(5). . ;:. Google Scholar
  119. Brzeska J, Morawska M, Sikorska W, Tercjak A, Kowalczuk M, Rutkowska M. Degradability of cross-linked polyurethanes based on synthetic polyhydroxybutyrate and modified with polylactide. Chemical Papers. 2017;71:2243-2251. . ;:. Google Scholar
  120. Chin YW, Jones WP, Rachman I, Riswan S, Kardono LB, Chai HB, et al. Cytotoxic lignans from the stems of Helicteres hirsuta collected in Indonesia. Phytotherapy Research. 2006;20(1):62-65. . ;:. Google Scholar
  121. Nguyen TT, Kretschmer N, Pferschy-Wenzig E-M, Kunert O, Bauer R. Triterpenoidal and phenolic compounds isolated from the aerial parts of Helicteres hirsuta and their cytotoxicity on several cancer cell lines. Natural Product Communications. 2019;14(1):1934578X1901400103. . ;:. Google Scholar
  122. Thang Hoang D, Hien Truong TT, Viet Duc N, Anh Hoang LT, Do TT, Vinh LB, et al. Hepatoprotective Effects of Extract of Helicteres hirsuta Lour. on Liver Fibrosis Induced by Carbon Tetrachloride in Rats. Applied Sciences. 2021;11(18):8758. . ;:. Google Scholar
  123. Pham HNT, Vuong Q, Bowyer MC, Scarlett CJ. Phytochemical profiles and antioxidant capacity of the crude extracts, aqueous-and saponin-enriched butanol fractions of Helicteres hirsuta Lour. leaves and stems. Chemical Papers. 2017;71:2233-2242. . ;:. Google Scholar
  124. Pham HNT, Sakoff JA, Bond DR, Vuong QV, Bowyer MC, Scarlett CJ. In vitro antibacterial and anticancer properties of Helicteres hirsuta Lour. leaf and stem extracts and their fractions. Molecular biology reports. 2018;45(6):2125-2133. . ;:. Google Scholar
  125. Son NT. Genus Miliusa: A review of phytochemistry and pharmacology. Evidence-based Complementary and Alternative Medicine. 2019;2019. . ;:. Google Scholar
  126. Promgool T, Kanokmedhakul K, Tontapha S, Amornkitbamrung V, Tongpim S, Jamjan W, et al. Bioactive homogentisic acid derivatives from fruits and flowers of Miliusa velutina. Fitoterapia. 2019;134:65-72. . ;:. Google Scholar
  127. Meena SN, Majik MS, Ghadi SC, Tilve SG. Quick identification of piperidine alkaloid from roots of Grewia nervosa and their glucosidase inhibitory activity. Chemistry and Biodiversity. 2017;14(12):e1700400. . ;:. Google Scholar
  128. Neha C, Abdussalam A. Biochemical studies on fruit extract of Grewia nervosa (lour.) Panigrahi: a promising wild plant. Plant Functional Biology. 2021:164. . ;:. Google Scholar
  129. Ramesh M, Rao C. Antioxidant capacity of hydroalcoholic extracts of Grewia serrulata DC and Grewia nervosa (Lour.) Panigrahi. International Journal of Research in Pharmaceutical Sciences. 2018;9(1):121-127. . ;:. Google Scholar
  130. Meena S, Sharma S, Kulshreshtha R, Janarthanam M, Ghadi S. Antiproliferative activity and phytochemical analysis of methanol leaf extract of Grewia nervosa. Current Science. 2017;113:1828-1830. . ;:. Google Scholar
  131. Rojsanga P, Bunsupa S, Sithisarn P. Flavones Contents in Extracts from Oroxylum indicum Seeds and Plant Tissue Cultures. 2020;25(7):1545-1552. . ;:. Google Scholar
  132. Dinda B, SilSarma I, Dinda M, Rudrapaul P. Oroxylum indicum (L.) Kurz, an important Asian traditional medicine: From traditional uses to scientific data for its commercial exploitation. Journal of Ethnopharmacology. 2015;161:255-278. . ;:. Google Scholar
  133. Moyo M, Amoo SO, Aremu AO, Gruz J, Šubrtová M, Jarošová M, et al. Determination of Mineral Constituents, Phytochemicals and Antioxidant Qualities of Cleome gynandra, Compared to Brassica oleracea and Beta vulgaris. Frontiers in Chemistry. 2018;5. . ;:. Google Scholar
  134. Kasem WT, Fatahy S. Flavonoids and isoenzymes as chemotaxonomic markers in Cleome L.(Cleomaceae Bercht. & J.Presl). Current Botany. 2016;7:11-16. . ;:. Google Scholar
  135. Moyo M, Aremu AO. Nutritional, phytochemical and diverse health-promoting qualities of Cleome gynandra. Critical Reviews in Food Science and Nutrition. 2022;62(13):3535-3552. . ;:. Google Scholar
  136. Imanirampa L, Alele PE. Antifungal activity of Cleome gynandra L. aerial parts for topical treatment of Tinea capitis: an in vitro evaluation. BMC Complementary and Alternative Medicine. 2016;16(1):194-201. . ;:. Google Scholar
  137. Narendhirakannan RT, Subramanian S, Kandaswamy M. Anti-inflammatory and lysosomal stability actions of Cleome gynandra L. studied in adjuvant induced arthritic rats. Food and Chemical Toxicology. 2007;45(6):1001-1012. . ;:. Google Scholar
  138. Adhikari PP, Paul SB. Medicinally important plant Cleome gynandra: A phytochemical and pharmacological explanation. Asian Journal of Pharmaceutical and Clinical Research. 2018;11(1):21-29. . ;:. Google Scholar
  139. Rahman A, Siddiqui S, Oke-Altuntas F, Okay S, Gül F, Demirtas I. Phenolic Profile, Essential Oil Composition and Bioactivity of Lasia spinosa (L.) Thwaites. Brazilian Archives of Biology and Technology. 2019;62:e19170757. . ;:. Google Scholar
  140. Goshwami D, Rahman MM, Muhit MA, Islam MS, Anasri M. Antioxidant Property, Cytotoxicity and Antimicrobial Activity of Lasia spinosa Leaves. Nepal Journal of Science and Technology. 2013;13(2):215-218. . ;:. Google Scholar
  141. Alam F, Haque M, Sohrab M, Monsur M, Hasan C, Ahmed N. Antimicrobial and Cytotoxic Activity from Lasia spinosa and Isolated Lignan. Latin American Journal of Pharmacy. 2011;30(3):550-553. . ;:. Google Scholar
  142. Das SK, Baruah M, Shill D. Evaluation of Antidiabetic Activity from the Stem of Lasia spinosa in Dexamethasone Induced Diabetic Albino Rats. Journal of Pharmaceutical, Chemical and Biological Sciences 2014;1(1). . ;:. Google Scholar
  143. Mahmood S, Atif M, Rashid S, Ahmed M, Rahman S. Evaluation of antihyperlipidemic activity of methanolic leaves extract of Lasia spinosa and its role in prevention of hyperlipidemia induced pancreatitis in rats. International Journal of Pharmaceutical Sciences and Research. 2015;6(4):1502-1508. . ;:. Google Scholar
  144. Atif M, Azharuddin M, Mahmood S. Gastroprotective potential of Lasia spinosa in albino rats. International Journal of Pharmacy and Pharmaceutical Sciences. 2015;7(3):254-257. . ;:. Google Scholar
  145. Thamizh Selvam N, Vasanth Kumar K, Acharya M. Physico-chemical, Phytochemical and Spectroscopic Characterization of various extracts of leaves and stems of L. Ipomoea pestigridis. Adv Pharm J. 2017;2:34-40. . ;:. Google Scholar
  146. Das S, Ganguly SN, Mukherjee KK. Fatty acids and phytochemical components of Ipomoea spp. seeds. Natural Product Sciences. 1999;5(3):121-123. . ;:. Google Scholar
  147. Okoruwa M. Effect of heat stress on thermoregulatory, live bodyweight and physiological responses of dwarf goats in southern Nigeria. European Scientific Journal. 2014;10(27). . ;:. Google Scholar
  148. Deb D, Dev S, Das AK, Khanam D, Banu H, Shahriar M, et al. Antinociceptive, anti-inflammatory and anti-diarrheal activities of the hydroalcoholic extract of Lasia spinosa Linn.(Araceae) roots. Latin American Journal of Pharmacy. 2010;29. . ;:. Google Scholar
  149. Chowdhury R, Saha R, Bhuiyan M, Hossain M, Kowsar S, Hossain M. An In vitro Assessment of Antimicrobial, Thrombolytic and Cytotoxic Activity on Ipomoea pes-tigridis. Journal of Advancement in Medical and Life Sciences. 2014;2(1):1-8. . ;:. Google Scholar
  150. Begum MSS, Aruna A, Sivakumar T, Premanand C, Sribhuaneswari MC. Invitro Cytotoxic Activity On Ethanolic Extracts Of Leaves Of Ipomoea Pes-Tigridis (Convolulaceae) Against Liver Hepg2 Cellline. International Journal of Ayurvedic and herbal Medicine. 2015;5(3):1778-1784. . ;:. Google Scholar
  151. Edeoga HO, Okwu D, Mbaebie B. Phytochemical constituents of some Nigerian medicinal plants. African journal of biotechnology. 2005;4(7):685-688. . ;:. Google Scholar
  152. Ghosh P, Biswas M, Biswas S, Dutta A, Hazra L, Nag SK, et al. Phytochemical screening, anti-oxidant and anti-microbial activity of leaves of Cleome rutidosperma DC. (Cleomaceae). Journal of Pharmaceutical Sciences and Research;. 2019;11(5):1790-1795. . ;:. Google Scholar
  153. Bose A, Mondal S, Gupta JK, Ghosh T, Dash GK, Si SJF. Analgesic, anti-inflammatory and antipyretic activities of the ethanolic extract and its fractions of Cleome rutidosperma. 2007;78(7-8):515-520. . ;:. Google Scholar
  154. Mondal S, Suresh P. Wound healing activity of Cleome rutidosperma DC. roots. International Current Pharmaceutical Journal. 2012;1(6):151-154. . ;:. Google Scholar
  155. Prabha S, Rao M, Kumar M. Evaluation of in vitro Antioxidant, Antibacterial and Anticancer activities of leaf extracts of Cleome rutidosperma. Research Journal of Pharmacy and Technology. 2017;10(8):2492-2496. . ;:. Google Scholar
  156. Ukil S, Laskar S, Roy RN. Physicochemical characterization and antibacterial activity of the leaf oil of Crotalaria pallida Aiton. Journal of Taibah University for Science. 2016;10(4):490-496. . ;:. Google Scholar
  157. Kumari R, Kumar S. Pharmacological, Phytochemical and Their Application of Crotalaria L. Genus. Genus. 2022. . ;:. Google Scholar
  158. Govindappa M, Bharath N, Shruthi H, Sadananda T, Sharanappa P. Antimicrobial, antioxidant and in vitro anti-inflammatory activity and phytochemical screening of Crotalaria pallida Aiton. African Journal of Pharmacy and Pharmacology 2011;5(21):2359-2371. . ;:. Google Scholar
  159. Rumondor EM, Moektiwardoyo M, Barliana MI. Anti-proliferative Activity of Crotalaria pallida Aiton on MCF-7 Breast Cancer Cells. Pharmacology and Clinical Pharmacy Research. 2017;2(3):63-65. . ;:. Google Scholar
  160. Miean KH, Mohamed S. Flavonoid (myricetin, quercetin, kaempferol, luteolin, and apigenin) content of edible tropical plants. Journal of Agricultural and Food Chemistry. 2001;49(6):3106-3112. . ;:. PubMed Google Scholar
  161. Zhang L, Wang H. FTY720 inhibits the Nrf2/ARE pathway in human glioblastoma cell lines and sensitizes glioblastoma cells to temozolomide. Pharmacological Reports. 2017;69(6):1186-1193. . ;:. Google Scholar
  162. Shin D, Kim EH, Lee J, Roh J-L. RITA plus 3-MA overcomes chemoresistance of head and neck cancer cells via dual inhibition of autophagy and antioxidant systems. Redox Biology. 2017;13:219-227. . ;:. Google Scholar
  163. Roh J-L, Kim EH, Jang H, Shin D. Nrf2 inhibition reverses the resistance of cisplatin-resistant head and neck cancer cells to artesunate-induced ferroptosis. Redox biology. 2017;11:254-262. . ;:. Google Scholar
  164. Abdelwahab SI, Abdul AB, Zain ZNM, Hadi AHA. Zerumbone inhibits interleukin-6 and induces apoptosis and cell cycle arrest in ovarian and cervical cancer cells. International Immunopharmacology. 2012;12(4):594-602. . ;:. Google Scholar
  165. Stefanowicz-Hajduk J, Sparzak-Stefanowska B, Krauze-Baranowska M, Ochocka JR. Securinine from Phyllanthus glaucus induces cell cycle arrest and apoptosis in human cervical cancer HeLa cells. PLoS One. 2016;11(10):e0165372. . ;:. Google Scholar
  166. Tang Y-Q, Sekaran SD. Evaluation of Phyllanthus for its anti-cancer properties. Prostate cancer-from bench to bedside. 2011:305-320. . ;:. Google Scholar
  167. Gao A-M, Ke Z-P, Shi F, Sun G-C, Chen H. Chrysin enhances sensitivity of BEL-7402/ADM cells to doxorubicin by suppressing PI3K/Akt/Nrf2 and ERK/Nrf2 pathway. Chemico-biological interactions. 2013;206(1):100-108. . ;:. Google Scholar
  168. Hasibuan PAZ, Harahap U, Sitorus P, Satria D. The anticancer activities of Vernonia amygdalina Delile. Leaves on 4T1 breast cancer cells through phosphoinositide 3-kinase (PI3K) pathway. Heliyon. 2020;6(7):e04449. . ;:. Google Scholar
  169. Quang DN, Pham CT, Le LTK, Ta QN, Dang NK, Hoang NT, et al. Cytotoxic constituents from Helicteres hirsuta collected in Vietnam. Natural product research. 2020;34(4):585-589. . ;:. PubMed Google Scholar
  170. Yu-Jen C. Potential role of tetrandrine in cancer therapy. Acta Pharmacol Sin. 2002;23:1102-1106. . ;:. Google Scholar
  171. Sova M, Saso L. Design and development of Nrf2 modulators for cancer chemoprevention and therapy: A review. Drug design, development and therapy. 2018:3181-3197. . ;:. PubMed Google Scholar


Author's Affiliation
Article Details

Issue: Vol 6 No 3 (2023)
Page No.: 1975-1999
Published: Sep 30, 2023
Section: Research article
DOI: https://doi.org/10.32508/stdjet.v6i3.1098

 Copyright Info

Creative Commons License

Copyright: The Authors. This is an open access article distributed under the terms of the Creative Commons Attribution License CC-BY 4.0., which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

 How to Cite
Nguyen, H., Le, H., Nguyen, N., Vo, H., Pham, T., & Yen, C.-H. (2023). Screening for in vitro inhibiting Nrf2 of some Vietnamese medicinal plants. VNUHCM Journal of Engineering and Technology, 6(3), 1975-1999. https://doi.org/https://doi.org/10.32508/stdjet.v6i3.1098

 Cited by



Article level Metrics by Paperbuzz/Impactstory
Article level Metrics by Altmetrics

 Article Statistics
HTML = 1494 times
PDF   = 429 times
XML   = 0 times
Total   = 429 times